View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_94 (Length: 204)
Name: NF2700_low_94
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_94 |
 | |
|
| [»] scaffold0171 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0171 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 9344 - 9513
Alignment:
| Q |
19 |
atatgatacaattatcttttctagtctctcatctttactactaaacgcgctctatattttttcataaaatctcatcttgtttgttctatgacttaaggat |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9344 |
atatgatacaattattttttctagtctctcatctttactactaaacgagctctatattttttcataaaatctcatcttgtttgttctatgacttaaggat |
9443 |
T |
|
| Q |
119 |
gatcgacaccacttaattccaaaccatgcagagtcgtgt-gtcgttgttatggcgaggaccaacatctaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9444 |
gatcgacaccacttaattccaaaccatgcagagtcgtgtcgtcgttgttatggcgaggaccaacatctaa |
9513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University