View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_96 (Length: 202)
Name: NF2700_low_96
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_96 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 12 - 177
Target Start/End: Original strand, 16207147 - 16207312
Alignment:
| Q |
12 |
aagaatattttgcaagtggatatggtcactcattgttgtttccatagcctccaactccacaacttcgataacgagagtttggtccttttctgtgtatttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
16207147 |
aagaatattttgcaagtggatatggtcactcattgttgtttccatagcctccaactccacaacttcgataacgagagtttggcccttttgtgtgtatttt |
16207246 |
T |
 |
| Q |
112 |
tatttttcgacccttaattacctctgcttgctcctcctttctgtttcattaagtgtgtttctctag |
177 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| | | ||| ||||||||||||| |
|
|
| T |
16207247 |
tatttttcgacccttaattagctctgcttgctcctcctttctgtcttagtaattgtgtttctctag |
16207312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University