View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2701_high_40 (Length: 211)
Name: NF2701_high_40
Description: NF2701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2701_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 45 - 194
Target Start/End: Complemental strand, 22610312 - 22610163
Alignment:
| Q |
45 |
tttcaaacatatggctcctaagatgacaccccaattgggtggatcataggatatgtggcagggctttgtttgcccatattttgtttgtctgtagtgtaat |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22610312 |
tttcaaacatatggctcctaagatgacaccccaattgggtggatcataggatatgtggcagggctttgtttgcccatgttttgtttgtctgtagtgtaat |
22610213 |
T |
 |
| Q |
145 |
tcagtcatataattgatcataatcatatgacgtgtgactgtcacttagta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22610212 |
tcagtcatataattgatcataatcatatgacgtgtgactgtcacttagta |
22610163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University