View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2701_low_29 (Length: 300)
Name: NF2701_low_29
Description: NF2701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2701_low_29 |
 | |
|
| [»] scaffold0170 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0170 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 19394 - 19180
Alignment:
| Q |
1 |
gagaatttctgaactttcatggctctgtagagttttttgtttgttcatacccggttcaacccacccgtcgaaaccgtatttcgcccaacccgaaaaccgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19394 |
gagaatttctgaactttcatggctctgtagaggattttgtttgttcatacccggttcaacccacccgtcgaaaccgtatttcacccaatccgaaaaccgc |
19295 |
T |
|
| Q |
101 |
aataacctagtgttgtgatgggcggaattggactgcttaataccacccgcggttgacgttcggatttagatttttgaaccgaaatccggccgaaccgacc |
200 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19294 |
aataaccgagtgttgtgatgggcggatttggactgcttaataccacccgcggttgacgttcggatttagatttttgaaccaaaatccggccgaaccgacc |
19195 |
T |
|
| Q |
201 |
gtttgtccaccccta |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19194 |
gtttgtccaccccta |
19180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 19604 - 19543
Alignment:
| Q |
1 |
gagaatttctgaactttcatggctctgtagagttttttgtttgttcatacccggttcaaccc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19604 |
gagaatttctgaactttcatggctctgtagaggattttgtttgttcatacccggttcaaccc |
19543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 216 - 290
Target Start/End: Original strand, 48531718 - 48531792
Alignment:
| Q |
216 |
ttgccagcaaacattaatgatgttcctcattttgtattatttcccttaatagcacaaggacacattatacctatg |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48531718 |
ttgccagcaaacattaatgatgttcctcattttgtattatttcccttaatagcacaaggacacattatacctatg |
48531792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 24214408 - 24214336
Alignment:
| Q |
143 |
ccacccgcggttgacgttcggatttagatttttgaaccgaaatccggccgaaccgaccgtttgtccaccccta |
215 |
Q |
| |
|
|||||||||||| | |||||||| || ||||| | |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
24214408 |
ccacccgcggtttgccttcggattgaggtttttcacccgaaatccgaccgaaccgaccgtttgtccagcccta |
24214336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 283
Target Start/End: Original strand, 41510354 - 41510418
Alignment:
| Q |
216 |
ttgccagcaaacattaatgatgttcctcattttgtattatttcccttaatagcacaaggacacattat |
283 |
Q |
| |
|
|||| |||||||||||||| |||| || ||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
41510354 |
ttgcaagcaaacattaatg---ttccacactttgtgttatttcctttaatagcacaaggccacattat |
41510418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 40158526 - 40158454
Alignment:
| Q |
143 |
ccacccgcggttgacgttcggatttagatttttgaaccgaaatccggccgaaccgaccgtttgtccaccccta |
215 |
Q |
| |
|
|||||||||||| | |||||||| || ||||| | || ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
40158526 |
ccacccgcggtttgccttcggattgaggtttttcacccaaaatccgaccgaaccgaccgtttgtccagcccta |
40158454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University