View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2701_low_34 (Length: 286)
Name: NF2701_low_34
Description: NF2701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2701_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 27745462 - 27745671
Alignment:
| Q |
1 |
gtcgtgtagcaaacgatcattgtggtctattatatgttttagtgtcacacatgctttgtttgatagacattacactccttaaaacacatggtaagcaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27745462 |
gtcgtgtagcaaacgatcattgtggtctattatatgttttagtgtcacacatgctttgtttgatagacattacactccttaaaacacatggtaagcaatc |
27745561 |
T |
 |
| Q |
101 |
aagacacgtataattcatattattgtatttttgtctgcagcatggattttttaactgtaatgatgatagatatacttgcatccccaatgtatatcttaga |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27745562 |
aagacatgtataattcatattattgtatttttgtctgcagcatggattttttaactgtaatgatggtagatatacttgcatccccaatgtatatcttaga |
27745661 |
T |
 |
| Q |
201 |
atatttaatc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
27745662 |
atatttaatc |
27745671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 202
Target Start/End: Original strand, 49514024 - 49514088
Alignment:
| Q |
138 |
cagcatggattttttaactgtaatgatgatagatatacttgcatccccaatgtatatcttagaat |
202 |
Q |
| |
|
|||||| ||||||||| | |||| ||||||| |||||| | |||| |||||||||||||||||| |
|
|
| T |
49514024 |
cagcatagattttttatccgtaacgatgataagtatactcgtatccgcaatgtatatcttagaat |
49514088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University