View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2701_low_35 (Length: 275)
Name: NF2701_low_35
Description: NF2701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2701_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 20 - 265
Target Start/End: Complemental strand, 30874034 - 30873789
Alignment:
| Q |
20 |
gctacctatgcaagaaagcgtcaaagagggatctgtgtccttagtgggagtggaacagtcactaacgtgaccctgcgacagccagctgccgcaggatctg |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30874034 |
gctacttatgcaagaaagcgtcaaagagggatctgtgtccttagtgggagtggaacagtcactaacgtgaccttgcgacagccagctgccgcaggatctg |
30873935 |
T |
|
| Q |
120 |
tagtgactttacacggaaggtttgaaatactttctttgtccggatcgtttctaccaccaccagctcctccaggagctacaagtttgagtgtgttccttgg |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30873934 |
tagtgactttacatggaaggtttgaaatactttctttgtccggatcgtttctaccaccaccagctcctccaggagctacaagtttgagtgtgttccttgg |
30873835 |
T |
|
| Q |
220 |
cggaggccaaggtcaagttgtgggaggaaatgttgttggtcctttg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30873834 |
tggaggccaaggtcaagttgtgggaggaaatgttgttggtcctttg |
30873789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University