View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2701_low_36 (Length: 274)
Name: NF2701_low_36
Description: NF2701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2701_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 3755837 - 3756084
Alignment:
| Q |
13 |
cataggcaaatttgtagaaagttgaatttcttgtttccttggaagacctgaaattccaaaattcaattcataaacaagtacctatccagtgtcaacaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3755837 |
cataggcaaatttgtagaaagttgaatttcttgtttccttggaagacctgaaattccaaaattcaattcataaacaagtacctatccagtgtcaacaaga |
3755936 |
T |
 |
| Q |
113 |
gcgtatacgaattgtttgcatgtctaaattgttcgatcttgaccaaacggtacaagttttagcttcttgt----gacctattttgcaaagtt-agataca |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
3755937 |
gcgtatacaaattgtttgcatgtctaaattgttcgatcttgaccaaacggtacaagctttagcttcttgttttggacctattttgcaaagttgagataca |
3756036 |
T |
 |
| Q |
208 |
ggtagaacaattaagatcaaagaatttaaaatgtatgactgtgtggtt |
255 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
3756037 |
agtagcacaattatgatcaaagaatttaaaatgtgtgactgtgtggtt |
3756084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University