View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2701_low_37 (Length: 272)

Name: NF2701_low_37
Description: NF2701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2701_low_37
NF2701_low_37
[»] chr8 (4 HSPs)
chr8 (19-189)||(5840607-5840779)
chr8 (81-189)||(5846813-5846927)
chr8 (211-258)||(5846944-5846991)
chr8 (211-250)||(5840798-5840837)
[»] chr4 (1 HSPs)
chr4 (22-179)||(6349858-6350016)


Alignment Details
Target: chr8 (Bit Score: 149; Significance: 9e-79; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 5840607 - 5840779
Alignment:
19 tttgttttctacttgctgctgcatttttgttttt-cttctgcccgtgttgccttctttgcgctaggttgttgtttaagcggtttggccttgattggcttt 117  Q
    |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5840607 tttgttttctacttgctgctgcatttttgttttttctgctgcccgtgttgccttctttgcgctaggttgttgtttaagcggtttggccttgattggcttt 5840706  T
118 tttgtattgttccccagctcttttactgcacttctgctgc-ggggggcttttgataaataaatattgcttttt 189  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||    
5840707 tttgtattgttccccagctcttttactgcacttctgctgcgggggggcttttgataaataaatattgtttttt 5840779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 81 - 189
Target Start/End: Original strand, 5846813 - 5846927
Alignment:
81 aggttgttgtttaagcggtttggccttgattggcttttttgtattgttccccagct------cttttactgcacttctgctgcggggggcttttgataaa 174  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||      |||||||||||||||||||||||||||  |||||||||    
5846813 aggttgttgtttaagcggtttggccttgattcgcttttttgtattgttccccatctcttttacttttactgcacttctgctgcgggggggctttgataaa 5846912  T
175 taaatattgcttttt 189  Q
    |||||||||||||||    
5846913 taaatattgcttttt 5846927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 211 - 258
Target Start/End: Original strand, 5846944 - 5846991
Alignment:
211 tgtctgtctttgtttaaagtttttcaattaagtcattgtctctatgtt 258  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||    
5846944 tgtctgtctttgtttaaagtttttcaattaggtcattgtctctatgtt 5846991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 211 - 250
Target Start/End: Original strand, 5840798 - 5840837
Alignment:
211 tgtctgtctttgtttaaagtttttcaattaagtcattgtc 250  Q
    ||| |||||||||||||||||||||||||| |||||||||    
5840798 tgtatgtctttgtttaaagtttttcaattaggtcattgtc 5840837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 22 - 179
Target Start/End: Complemental strand, 6350016 - 6349858
Alignment:
22 gttttctacttgctgctgcatttttgtttttcttctgcccgtgt--tgccttctttgcgctaggttgttgtttaagcggtttggccttgattggcttttt 119  Q
    |||||||| |||||||||| ||||||||||||| ||||| ||||  |||||||| ||||| ||||||||||||||| |||||||||||||| ||| |||     
6350016 gttttctatttgctgctgcttttttgtttttctgctgcctgtgtgttgccttctatgcgccaggttgttgtttaaggggtttggccttgataggc-tttg 6349918  T
120 tgtattgttccccagctcttttactgcacttctgctgcggggggcttttgataaataaat 179  Q
    ||||| |||||  | |||||||  |||||||||||||| |||| |||||||| |||||||    
6349917 tgtatggttccataactctttttatgcacttctgctgcaggggacttttgattaataaat 6349858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University