View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2701_low_41 (Length: 235)
Name: NF2701_low_41
Description: NF2701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2701_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 217
Target Start/End: Complemental strand, 40613908 - 40613693
Alignment:
| Q |
2 |
aagaaaaaccacaagatgttcctgaagatcttttctatgttcttcaacaactcaagaacactatggttctttttcaaagtcatcaacagagtaaagaagc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40613908 |
aagaaaaaccacaagatgttcctgaagatcttttctatgttctccaacaactcaagaacactatggttctttttcaaagtcatcaacagagaaaagaagc |
40613809 |
T |
 |
| Q |
102 |
tcttcaccttcttcaacttgataagatgtttcaaacctttggtgatcttattcaaagagcttctgaattggtttctcctgatgaagatagaaagataaag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40613808 |
tcttcaccttcttcaacttgataagatgtttcaaacctttggtgatcttattcaaagagcttctgaattggtttctcctgatgaagataggaagataaag |
40613709 |
T |
 |
| Q |
202 |
aaacttcccactttat |
217 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40613708 |
aaacttcccactttat |
40613693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University