View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2702_high_10 (Length: 298)
Name: NF2702_high_10
Description: NF2702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2702_high_10 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 157 - 298
Target Start/End: Original strand, 33026733 - 33026875
Alignment:
| Q |
157 |
tttgggaacttttgcttggctcaaatggaatctatcatctaataatattgaaaatatagttt-gctttgacagcttttgtctggggtagtcgttaatatg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33026733 |
tttgggaacttttgcttggctcaaatggaatctatcatctaatgatattgaaaatatagttttgctttgaaagcttttgtttggggtagtcgttaatatg |
33026832 |
T |
 |
| Q |
256 |
ttgtgaaaagaccatagctctcttatatttgagcaacactctc |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33026833 |
ttgtgaaaagaccatagctctcttatatttgagaaacactctc |
33026875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 114
Target Start/End: Original strand, 33026694 - 33026736
Alignment:
| Q |
72 |
ataatgcaaatcgtagagattgcgatgatgtgaaactgttttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026694 |
ataatgcaaatcgtagagattgcgatgatgtgaaactgttttg |
33026736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University