View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2702_high_11 (Length: 285)
Name: NF2702_high_11
Description: NF2702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2702_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 96 - 181
Target Start/End: Complemental strand, 22062430 - 22062345
Alignment:
| Q |
96 |
tagttcattgaatttgcactattttcccccaatttccagggttttagagttccaagatcatgttcccaaaattttgtttgattttg |
181 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
22062430 |
tagttcattgaatttgcactatttccccctaatttccagggttttagagttccaagatcatgtttccaaatttttgtttgattttg |
22062345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 234 - 269
Target Start/End: Complemental strand, 22062350 - 22062315
Alignment:
| Q |
234 |
attttgctccagaattgcgttggatactgcaccttt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22062350 |
attttgctccagaattgcgttggatactgcaccttt |
22062315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University