View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2702_low_10 (Length: 400)
Name: NF2702_low_10
Description: NF2702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2702_low_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 87 - 400
Target Start/End: Original strand, 29481522 - 29481835
Alignment:
| Q |
87 |
aatatcaaggatgacaaacaaaactacccttaaattccaactcaccgagattaacttggcgattatcggccatcataggcttaacaagcatctgcacctc |
186 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29481522 |
aatatcaaggatcacaaacaaaactaccattaaattccaactcaccgagattaacttggcgattatcggccatcataggcttaacaagcatctgcacctc |
29481621 |
T |
|
| Q |
187 |
ccacttcttaagcggctcaccaagtatctcctctctactcaccccttcttcaggaaacttcccaaccggaaacggccccggcatttcaactttcttaaca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29481622 |
ccacttcttaagcggctcaccaagtatctcctctctactcaccccttcttcaggaaacttcccaaccggaaacggccccggcatttcaactttcttgaca |
29481721 |
T |
|
| Q |
287 |
cctttcatcccttccggaggaggattaaacgaatcaaacagcggaatattcttcttcgacttcttcaacggtgctttccctgtccatggcctcggcattg |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29481722 |
cctttcatcccttccggaggaggattaaacgaatcaaacagcggaatattcttcttcgacttcttcaacggtgctttccctgtccacggcctcggcattg |
29481821 |
T |
|
| Q |
387 |
tgggaggttcaaac |
400 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29481822 |
tgggaggttcaaac |
29481835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University