View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2702_low_17 (Length: 298)

Name: NF2702_low_17
Description: NF2702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2702_low_17
NF2702_low_17
[»] chr1 (2 HSPs)
chr1 (157-298)||(33026733-33026875)
chr1 (72-114)||(33026694-33026736)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 157 - 298
Target Start/End: Original strand, 33026733 - 33026875
Alignment:
157 tttgggaacttttgcttggctcaaatggaatctatcatctaataatattgaaaatatagttt-gctttgacagcttttgtctggggtagtcgttaatatg 255  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||    
33026733 tttgggaacttttgcttggctcaaatggaatctatcatctaatgatattgaaaatatagttttgctttgaaagcttttgtttggggtagtcgttaatatg 33026832  T
256 ttgtgaaaagaccatagctctcttatatttgagcaacactctc 298  Q
    ||||||||||||||||||||||||||||||||| |||||||||    
33026833 ttgtgaaaagaccatagctctcttatatttgagaaacactctc 33026875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 114
Target Start/End: Original strand, 33026694 - 33026736
Alignment:
72 ataatgcaaatcgtagagattgcgatgatgtgaaactgttttg 114  Q
    |||||||||||||||||||||||||||||||||||||||||||    
33026694 ataatgcaaatcgtagagattgcgatgatgtgaaactgttttg 33026736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University