View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2702_low_23 (Length: 263)
Name: NF2702_low_23
Description: NF2702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2702_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 42 - 244
Target Start/End: Complemental strand, 937359 - 937157
Alignment:
| Q |
42 |
tatacctcggttgaacctttgaacctgtctcctgtttcgcatgcctagtcttcaaattactctcaccatcaagattaatagtttgcacatatgcaacacc |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
937359 |
tatacctcggttgaacctttgaacctgtctcctgtttcgcatacctagtcttcaaattactctcaccatcaagattaatagtttgcacatatgcaacacc |
937260 |
T |
|
| Q |
142 |
agttggatcactagttgataacaaaacaatatcacaaggaattgtttcattcgttttgatttttacaatctcaccaacacgaatatccttccatttcatc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
937259 |
agttggatcactagttgataacaaaacaatatcacaaggaattgtttcatttgttttgatttttacaatctcaccaacacgaatatccttccatttcttc |
937160 |
T |
|
| Q |
242 |
tca |
244 |
Q |
| |
|
||| |
|
|
| T |
937159 |
tca |
937157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 68 - 244
Target Start/End: Complemental strand, 16941811 - 16941635
Alignment:
| Q |
68 |
gtctcctgtttcgcatgcctagtcttcaaattactctcaccatcaagattaatagtttgcacatatgcaacaccagttggatcactagttgataacaaaa |
167 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||| ||||||||| ||||||| |||||| || || ||||||||||| |||||||| || || ||||||| |
|
|
| T |
16941811 |
gtctcttgttttgcatatctagtcttcaaattagactcaccatctagattaagagtttgaacgtaagcaacaccagtaggatcactcgtcgacaacaaaa |
16941712 |
T |
|
| Q |
168 |
caatatcacaaggaattgtttcattcgttttgatttttacaatctcaccaacacgaatatccttccatttcatctca |
244 |
Q |
| |
|
||| |||||||||||| | |||||| | |||||||| | ||||||||||| | |||||| ||||||||| ||||| |
|
|
| T |
16941711 |
caaaatcacaaggaatcggttcatttgcattgattttaatgatctcaccaactctaatatctttccatttcttctca |
16941635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University