View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2702_low_26 (Length: 229)
Name: NF2702_low_26
Description: NF2702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2702_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 18189310 - 18189086
Alignment:
| Q |
1 |
tctggcagcacacgcagcaacggatcctcatgcattccagaaccttctccgacctcacaacttgatctattcccctcaaccaagttaacattcccaccat |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18189310 |
tctggtagcacacgcagcaacggatcctcatgcattccagaaccttctccgacctcacaacttgatctattcccctcaaccaatttaacattcccaccat |
18189211 |
T |
|
| Q |
101 |
cttgaacaacttgagtttcagcattttcttcctcgcgcattccagaaccttctccgacctcacaacttgatctattcccctcaaccaagttaacattccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||| ||||||||||| ||| |
|
|
| T |
18189210 |
cttgaacaacttgagtttcagcattttcttcctcgcgcattccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatcccc |
18189111 |
T |
|
| Q |
201 |
accatcttgaacaacttgagtttca |
225 |
Q |
| |
|
| ||| | || |||||||||||||| |
|
|
| T |
18189110 |
agcatttggagcaacttgagtttca |
18189086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 137 - 229
Target Start/End: Complemental strand, 18189279 - 18189187
Alignment:
| Q |
137 |
gcattccagaaccttctccgacctcacaacttgatctattcccctcaaccaagttaacattcccaccatcttgaacaacttgagtttcagcat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189279 |
gcattccagaaccttctccgacctcacaacttgatctattcccctcaaccaatttaacattcccaccatcttgaacaacttgagtttcagcat |
18189187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 125
Target Start/End: Complemental strand, 18189174 - 18189081
Alignment:
| Q |
32 |
gcattccagaaccttctccgacctcacaacttgatctattcccctcaaccaagttaacattcccaccatcttgaacaacttgagtttcagcatt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | ||||||||| ||||||||||| |||| ||| | || |||||||||||||| |||| |
|
|
| T |
18189174 |
gcattccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatccccagcatttggagcaacttgagtttcaacatt |
18189081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University