View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2703_high_43 (Length: 306)

Name: NF2703_high_43
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2703_high_43
NF2703_high_43
[»] chr4 (7 HSPs)
chr4 (6-290)||(19262802-19263077)
chr4 (143-182)||(20973933-20973972)
chr4 (169-232)||(25950581-25950644)
chr4 (142-232)||(8457876-8457973)
chr4 (199-232)||(25486582-25486615)
chr4 (138-190)||(21732367-21732419)
chr4 (192-232)||(55258375-55258415)
[»] scaffold0024 (1 HSPs)
scaffold0024 (137-234)||(21045-21143)
[»] chr7 (4 HSPs)
chr7 (138-230)||(24674239-24674332)
chr7 (138-220)||(9778470-9778552)
chr7 (138-187)||(12843041-12843090)
chr7 (139-183)||(12667976-12668020)
[»] chr8 (5 HSPs)
chr8 (186-242)||(39820369-39820425)
chr8 (169-232)||(8342930-8342993)
chr8 (169-220)||(25566811-25566862)
chr8 (137-196)||(32691737-32691796)
chr8 (147-229)||(28810335-28810417)
[»] chr6 (5 HSPs)
chr6 (139-206)||(19343526-19343593)
chr6 (157-220)||(28715265-28715328)
chr6 (186-232)||(6389693-6389739)
chr6 (143-231)||(8623160-8623252)
chr6 (192-240)||(5984280-5984328)
[»] chr3 (2 HSPs)
chr3 (138-230)||(21768564-21768658)
chr3 (138-190)||(28576716-28576768)
[»] chr5 (4 HSPs)
chr5 (137-233)||(9878038-9878138)
chr5 (141-234)||(41015775-41015870)
chr5 (147-233)||(9897899-9897986)
chr5 (138-232)||(31084279-31084375)
[»] chr1 (4 HSPs)
chr1 (119-161)||(15577916-15577958)
chr1 (138-196)||(29230059-29230117)
chr1 (142-182)||(9656775-9656815)
chr1 (137-189)||(18556032-18556084)
[»] scaffold0019 (1 HSPs)
scaffold0019 (139-196)||(104441-104498)
[»] chr2 (3 HSPs)
chr2 (165-230)||(19962470-19962535)
chr2 (138-167)||(34006838-34006867)
chr2 (138-219)||(42205842-42205925)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 6 - 290
Target Start/End: Original strand, 19262802 - 19263077
Alignment:
6 acaatccaagcagttccaatcaaaccctttaattatttgattttcatttttctacatcatgagctccgtaacaccgacacttttaataaaaggtgtgtcc 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
19262802 acaatccaagcagttccaatcaaaccctttaattatttgattttcatttttctacatcatgagctccgtaacaccgacacttctaataaaaggtgtgtcc 19262901  T
106 agtgtctaacatgtgtcattgtcaacactattgacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtcagtgtcactgtcgtg 205  Q
    ||||||  |||||||||  |||||||   ||||||||||||||||| |||||||||| ||||||| |||||||||||| ||||||||      |||||||    
19262902 agtgtccgacatgtgtcggtgtcaac---attgacacatgtgattacattcaattatgtcatcttctcaaattattactggtgtcag------tgtcgtg 19262992  T
206 tccggtgtctgtgtcagtgcttcatagatcatgagatcaaaattgaaagctaataattagacttaattgtaactgacctggtttg 290  Q
    ||||||||||||||  |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19262993 tccggtgtctgtgttcgtgcttcacagatcatgagatcaaaattgaaagctaataattagacttaattgtaactgacctggtttg 19263077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 143 - 182
Target Start/End: Complemental strand, 20973972 - 20973933
Alignment:
143 atgtgattatattcaattatatcatcttttcaaattatta 182  Q
    ||||||||| |||||||||||||||||| |||||||||||    
20973972 atgtgattacattcaattatatcatcttctcaaattatta 20973933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 25950581 - 25950644
Alignment:
169 ttttcaaattattaccggtgtcagtgtcactgtcgtgtccggtgtctgtgtcagtgcttcatag 232  Q
    |||||||||||||| ||||||| ||||   ||| |||||||||||||||||| |||||| ||||    
25950581 ttttcaaattattatcggtgtcggtgttcatgttgtgtccggtgtctgtgtccgtgctttatag 25950644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 142 - 232
Target Start/End: Complemental strand, 8457973 - 8457876
Alignment:
142 catgtgattatattcaattatatcatcttttcaaattattaccggtgtca-gtgtcactgtcgtgtccggtgtc------tgtgtcagtgcttcatag 232  Q
    |||||||||| |||||||||| |||| || ||||||||||||| |||  | |||||| ||| ||||||||||||      ||||||||||||||||||    
8457973 catgtgattacattcaattatgtcattttctcaaattattaccagtgagatgtgtcagtgttgtgtccggtgtccatgcatgtgtcagtgcttcatag 8457876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 232
Target Start/End: Original strand, 25486582 - 25486615
Alignment:
199 tgtcgtgtccggtgtctgtgtcagtgcttcatag 232  Q
    ||||||||||||||||||||||| ||||||||||    
25486582 tgtcgtgtccggtgtctgtgtcaatgcttcatag 25486615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 190
Target Start/End: Original strand, 21732367 - 21732419
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtc 190  Q
    |||||||||||||| | |||||||| |||| ||||||||||  ||||||||||    
21732367 gacacatgtgattacaatcaattatgtcattttttcaaattcctaccggtgtc 21732419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 232
Target Start/End: Complemental strand, 55258415 - 55258375
Alignment:
192 gtgtcactgtcgtgtccggtgtctgtgtcagtgcttcatag 232  Q
    |||||| |||||||||  |||||||||||||||||||||||    
55258415 gtgtcagtgtcgtgtctagtgtctgtgtcagtgcttcatag 55258375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 137 - 234
Target Start/End: Complemental strand, 21143 - 21045
Alignment:
137 tgacacatgtgattatattcaattatatcatcttttcaaattattaccggtgt--cagtgtcactgtcgtgtccggtgtctgtgtcagtgcttcatagat 234  Q
    ||||||||||||||| |||||  ||| |||| |||| |||||||| |||||||  | |||||| ||||||||| |||||||||||| |||||||||||||    
21143 tgacacatgtgattacattcagctatgtcatttttt-aaattattgccggtgttgctgtgtcaatgtcgtgtctggtgtctgtgtcggtgcttcatagat 21045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 138 - 230
Target Start/End: Complemental strand, 24674332 - 24674239
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccg-gtgtcagtgtcactgtcgtgtccggtgtctgtgtcagtgcttcat 230  Q
    |||||||||||||| |||||||||  |||| |   |||||||| |||| ||||| |||||| |||||||||  |||||||||||||||||||||    
24674332 gacacatgtgattacattcaattagttcatttacccaaattatcaccgtgtgtcggtgtcagtgtcgtgtcacgtgtctgtgtcagtgcttcat 24674239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 138 - 220
Target Start/End: Complemental strand, 9778552 - 9778470
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtcagtgtcactgtcgtgtccggtgtctgtgtc 220  Q
    ||||| ||| |||||| | |||||| | || |||||||||||| | | |||||||||||  |||||||||||||||| |||||    
9778552 gacacttgtaattatactgaattatgtgattttttcaaattatcagctgtgtcagtgtccgtgtcgtgtccggtgtccgtgtc 9778470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 138 - 187
Target Start/End: Original strand, 12843041 - 12843090
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccggt 187  Q
    ||||| ||||||||||||||||||| |||| || |||||||| |||||||    
12843041 gacacgtgtgattatattcaattatgtcattttctcaaattaataccggt 12843090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 183
Target Start/End: Original strand, 12667976 - 12668020
Alignment:
139 acacatgtgattatattcaattatatcatcttttcaaattattac 183  Q
    ||||||||||||| ||||||||||| ||| ||||||||| |||||    
12667976 acacatgtgattacattcaattataccattttttcaaataattac 12668020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 242
Target Start/End: Complemental strand, 39820425 - 39820369
Alignment:
186 gtgtcagtgtcactgtcgtgtccggtgtctgtgtcagtgcttcatagatcatgagat 242  Q
    ||||| |||||  |||||||||||||||||||||| ||||||||||| ||| |||||    
39820425 gtgtcggtgtctgtgtcgtgtccggtgtctgtgtccgtgcttcataggtcaagagat 39820369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 232
Target Start/End: Complemental strand, 8342993 - 8342930
Alignment:
169 ttttcaaattattaccggtgtcagtgtcactgtcgtgtccggtgtctgtgtcagtgcttcatag 232  Q
    |||||||||||||| |  |||| |||||| ||||||||||| |||| ||||| |||||||||||    
8342993 ttttcaaattattagctatgtcggtgtcagtgtcgtgtccgatgtccgtgtccgtgcttcatag 8342930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 220
Target Start/End: Complemental strand, 25566862 - 25566811
Alignment:
169 ttttcaaattattaccggtgtcagtgtcactgtcgtgtccggtgtctgtgtc 220  Q
    |||||||||||||| | |||||||||||  |||| |||||||||||||||||    
25566862 ttttcaaattattagctgtgtcagtgtctgtgtcatgtccggtgtctgtgtc 25566811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 137 - 196
Target Start/End: Complemental strand, 32691796 - 32691737
Alignment:
137 tgacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtcagtgtc 196  Q
    ||||||||||||||| |||||||||| |||| || | |||||| ||||||||||| ||||    
32691796 tgacacatgtgattacattcaattatgtcattttcttaaattactaccggtgtcaatgtc 32691737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 147 - 229
Target Start/End: Original strand, 28810335 - 28810417
Alignment:
147 gattatattcaattatatcatcttttcaaattattaccggtgtcagtgtcactgtcgtgtccggtgtctgtgtcagtgcttca 229  Q
    ||||| ||| |||||| |||| || ||| ||||||||  ||||||||| |||| | |||| |||||||| |||||||||||||    
28810335 gattacatttaattatgtcattttctcacattattacgagtgtcagtgccactcttgtgttcggtgtctatgtcagtgcttca 28810417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 19343526 - 19343593
Alignment:
139 acacatgtgattatattcaattatatcatcttttcaaattattaccggtgtcagtgtcactgtcgtgt 206  Q
    ||||||||||||| ||| ||| || |||  ||||||||||| || |||||||||||||| ||||||||    
19343526 acacatgtgattacattgaatcatgtcactttttcaaattaatatcggtgtcagtgtcaatgtcgtgt 19343593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 157 - 220
Target Start/End: Complemental strand, 28715328 - 28715265
Alignment:
157 aattatatcatcttttcaaattattaccggtgtcagtgtcactgtcgtgtccggtgtctgtgtc 220  Q
    |||||| |||| |||||||||||||| | |||||||||||  | |||||||||||||| |||||    
28715328 aattatgtcattttttcaaattattagccgtgtcagtgtccgtatcgtgtccggtgtccgtgtc 28715265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 6389739 - 6389693
Alignment:
186 gtgtcagtgtcactgtcgtgtccggtgtctgtgtcagtgcttcatag 232  Q
    |||| ||||||  |||||||||||||||||||||| |||||||||||    
6389739 gtgtgagtgtccgtgtcgtgtccggtgtctgtgtccgtgcttcatag 6389693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 143 - 231
Target Start/End: Complemental strand, 8623252 - 8623160
Alignment:
143 atgtgattatattcaattatatcatcttttcaaattattaccggtgtca--gtgtcactgtcgtgtccggtgtc--tgtgtcagtgcttcata 231  Q
    ||||||||| ||||||| || |||| || | ||||| ||| ||||||||  |||||| ||||||||||||||||   ||||||||||||||||    
8623252 atgtgattacattcaatgatgtcattttctaaaattgttatcggtgtcaacgtgtcagtgtcgtgtccggtgtcaacgtgtcagtgcttcata 8623160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 240
Target Start/End: Complemental strand, 5984328 - 5984280
Alignment:
192 gtgtcactgtcgtgtccggtgtctgtgtcagtgcttcatagatcatgag 240  Q
    |||||| |||||||||| |||||||  ||| ||||||||||||||||||    
5984328 gtgtcagtgtcgtgtccagtgtctgcctcaatgcttcatagatcatgag 5984280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 138 - 230
Target Start/End: Complemental strand, 21768658 - 21768564
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtca--gtgtcactgtcgtgtccggtgtctgtgtcagtgcttcat 230  Q
    |||||||||| |||  ||||| ||  |||| || ||||||||||||| || ||   |||||| ||||||||||||||| ||||||||||||||||    
21768658 gacacatgtggttacgttcaaataattcattttctcaaattattaccagtatcgacgtgtcaatgtcgtgtccggtgtatgtgtcagtgcttcat 21768564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 190
Target Start/End: Complemental strand, 28576768 - 28576716
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtc 190  Q
    ||||||||| |||| |||||||| | |||| || |||||||||||||||||||    
28576768 gacacatgtaattacattcaattttgtcattttctcaaattattaccggtgtc 28576716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 233
Target Start/End: Original strand, 9878038 - 9878138
Alignment:
137 tgacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtc--agtgtcactgtcgtgtccggtgtc--tgtgtcagtgcttcatag 232  Q
    ||||||| ||||||| |||||||||  |||| || |||||||||||  ||||||   |||||| |||| ||| |||||||  ||||||||||||||||||    
9878038 tgacacaagtgattacattcaattaattcatattctcaaattattattggtgtcgacgtgtcagtgtcttgttcggtgtctatgtgtcagtgcttcatag 9878137  T
233 a 233  Q
    |    
9878138 a 9878138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 234
Target Start/End: Original strand, 41015775 - 41015870
Alignment:
141 acatgtgattatattcaattatatcatcttttcaaattattaccggtgtcagtgtcactg---tcgtgtccggtgtctgtgtcagtgcttcatagat 234  Q
    |||||||| |||||||||||||  ||| |||||||| ||||||| |||||||||||| ||   | ||||||| | ||||||| |||| |||||||||    
41015775 acatgtgactatattcaattatgacattttttcaaa-tattacctgtgtcagtgtcagtgtacttgtgtccgatatctgtgttagtgtttcatagat 41015870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 233
Target Start/End: Original strand, 9897899 - 9897986
Alignment:
147 gattatattcaattatatcatcttttcaaattattaccggtgtca--gtgtcactgtcgtgtccggtgtctgtgtcagtgcttcataga 233  Q
    ||||||||||||||| ||||| || |||||||||||  ||||||   |||| | || |||||||||||||| | |||||||||||||||    
9897899 gattatattcaatta-atcatattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtctatatcagtgcttcataga 9897986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 138 - 232
Target Start/End: Complemental strand, 31084375 - 31084279
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtcag--tgtcactgtcgtgtccggtgtctgtgtcagtgcttcatag 232  Q
    ||||| ||| |||| ||| |||||| | || |||||||||||||| | ||||| |  ||||| ||||||||||||||||  |||| |||||||||||    
31084375 gacacttgtaattacattgaattatgtgattttttcaaattattagctgtgtcggcgtgtcagtgtcgtgtccggtgtccatgtctgtgcttcatag 31084279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 119 - 161
Target Start/End: Original strand, 15577916 - 15577958
Alignment:
119 tgtcattgtcaacactattgacacatgtgattatattcaatta 161  Q
    ||||| |||| |||||| |||||||||||||||||||||||||    
15577916 tgtcagtgtccacactactgacacatgtgattatattcaatta 15577958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 138 - 196
Target Start/End: Complemental strand, 29230117 - 29230059
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtcagtgtc 196  Q
    ||||||||  |||| |||||||||| |||| || |||||||||||||||||||| ||||    
29230117 gacacatgatattacattcaattatgtcattttctcaaattattaccggtgtcaatgtc 29230059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 142 - 182
Target Start/End: Original strand, 9656775 - 9656815
Alignment:
142 catgtgattatattcaattatatcatcttttcaaattatta 182  Q
    |||||||||| ||||||||| ||||| ||||||||||||||    
9656775 catgtgattacattcaattaaatcattttttcaaattatta 9656815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 18556032 - 18556084
Alignment:
137 tgacacatgtgattatattcaattatatcatcttttcaaattattaccggtgt 189  Q
    ||||||||||||||| | |||||||| |||| || | ||||||||||||||||    
18556032 tgacacatgtgattacagtcaattatgtcattttattaaattattaccggtgt 18556084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 104498 - 104441
Alignment:
139 acacatgtgattatattcaattatatcatcttttcaaattattaccggtgtcagtgtc 196  Q
    |||||||| |||| |||||||| | |||  ||||||||||| ||||||||||||||||    
104498 acacatgttattacattcaattctgtcactttttcaaattactaccggtgtcagtgtc 104441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 230
Target Start/End: Original strand, 19962470 - 19962535
Alignment:
165 catcttttcaaattattaccggtgtcagtgtcactgtcgtgtccggtgtctgtgtcagtgcttcat 230  Q
    |||||| |||||||| || ||||||||||| || || ||||||  ||||||||||| |||||||||    
19962470 catcttctcaaattactatcggtgtcagtgccaatggcgtgtcttgtgtctgtgtcggtgcttcat 19962535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 138 - 167
Target Start/End: Complemental strand, 34006867 - 34006838
Alignment:
138 gacacatgtgattatattcaattatatcat 167  Q
    ||||||||||||||||||||||||||||||    
34006867 gacacatgtgattatattcaattatatcat 34006838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 219
Target Start/End: Original strand, 42205842 - 42205925
Alignment:
138 gacacatgtgattatattcaattatatcatcttttcaaattattaccggtgtcag--tgtcactgtcgtgtccggtgtctgtgt 219  Q
    ||||||| ||||||| ||||||||  |||| || |||||||||||  |||||  |  ||||| |||||||||||||||||||||    
42205842 gacacatatgattattttcaattaagtcattttctcaaattattattggtgttggcatgtcaatgtcgtgtccggtgtctgtgt 42205925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University