View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2703_high_58 (Length: 241)
Name: NF2703_high_58
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2703_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 399806 - 399592
Alignment:
| Q |
1 |
ataaagtctatactttcagcatagcaacaaaaaatgaaattga-tcatttttaagagaacaagagtaaaataaagtggtccttcttttgggatatacatt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
399806 |
ataaagtctatactttcagcatagcaacaaaaaataaaattgaattttttttaagagaacaagagtaaaataaagtggtccttcttttgggatat----- |
399712 |
T |
 |
| Q |
100 |
ggtatattcattcgagatgtttaagatccctttgttttggttaaaattgaatggttttctttcatgtgtgttgttaacattggagaagctattgatcata |
199 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
399711 |
-------tcatttgagatgattaagatccctttgttttggtcaaaattgaatggttttctttcatgtgtgttgttaacattggagaaactattgatcata |
399619 |
T |
 |
| Q |
200 |
tttctgctctttaataagagttgttgg |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
399618 |
tttctgctctttaataagagttgttgg |
399592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University