View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2703_high_66 (Length: 229)
Name: NF2703_high_66
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2703_high_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 53184690 - 53184876
Alignment:
| Q |
12 |
aagcaaagggaggtggtttattaaaatgtgtctaagaagattggaaataagtgtaccactgtgtttggtatgaaccttcgttggagggggttctgaaggg |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53184690 |
aagctaagggaggtggtttattaaaatgtgtctaagaagattggaaataagtgtaccactgtgtttggtatgaaccttcgttggagggggttctgaaggg |
53184789 |
T |
 |
| Q |
112 |
tccatcatattcatagaccatagtgattatttaattcagtgattgatacaaatatctatatctgtgtgaaggatatcgttaatagtaacggagtccgagt |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53184790 |
tccatcatatt-------catagtgattatttaattcagtgattgatacaa------atatctgtgtgaaggatatggttaatagtaacggagtccgagt |
53184876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University