View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2703_high_66 (Length: 229)

Name: NF2703_high_66
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2703_high_66
NF2703_high_66
[»] chr4 (1 HSPs)
chr4 (12-211)||(53184690-53184876)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 53184690 - 53184876
Alignment:
12 aagcaaagggaggtggtttattaaaatgtgtctaagaagattggaaataagtgtaccactgtgtttggtatgaaccttcgttggagggggttctgaaggg 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53184690 aagctaagggaggtggtttattaaaatgtgtctaagaagattggaaataagtgtaccactgtgtttggtatgaaccttcgttggagggggttctgaaggg 53184789  T
112 tccatcatattcatagaccatagtgattatttaattcagtgattgatacaaatatctatatctgtgtgaaggatatcgttaatagtaacggagtccgagt 211  Q
    |||||||||||       |||||||||||||||||||||||||||||||||      ||||||||||||||||||| |||||||||||||||||||||||    
53184790 tccatcatatt-------catagtgattatttaattcagtgattgatacaa------atatctgtgtgaaggatatggttaatagtaacggagtccgagt 53184876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University