View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2703_high_72 (Length: 205)
Name: NF2703_high_72
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2703_high_72 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 43061514 - 43061718
Alignment:
| Q |
1 |
tatgttgatttactgcttttcttcacactagagcaaattttgttgaaacctttcttgcaaactagaattttttcattctgagcagtaaaattttgttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43061514 |
tatgttgatttactgcttttcttcacactagagcaaattttgttgaaacctttcttgcaaactagaattttttcattctgagcagtaaaattttgttgaa |
43061613 |
T |
 |
| Q |
101 |
accttactatatgtaacctaggcaacgccgggtaaatacgctagttatatgaatttttcataagttaatgtttcccgttaagagctaaattagaaaatta |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43061614 |
accttactatatgtaacctgggcaacgccgggtaaatacgctagttatatgaatttttcataagttaatgtttcccattaagagctaaattagaaaatta |
43061713 |
T |
 |
| Q |
201 |
atcgc |
205 |
Q |
| |
|
||||| |
|
|
| T |
43061714 |
atcgc |
43061718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 108 - 147
Target Start/End: Complemental strand, 11874047 - 11874008
Alignment:
| Q |
108 |
tatatgtaacctaggcaacgccgggtaaatacgctagtta |
147 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
11874047 |
tatatgtaacccaggcaacgtcgggtaaatacgctagtta |
11874008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 9855626 - 9855586
Alignment:
| Q |
108 |
tatatgtaacctaggcaacgccgggtaaatacgctagttat |
148 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
9855626 |
tatatgtaatctgggcaacgccggataaatacgctagttat |
9855586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University