View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2703_high_73 (Length: 202)

Name: NF2703_high_73
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2703_high_73
NF2703_high_73
[»] chr8 (2 HSPs)
chr8 (5-115)||(38029331-38029441)
chr8 (172-202)||(38029248-38029278)


Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 5 - 115
Target Start/End: Complemental strand, 38029441 - 38029331
Alignment:
5 cacatgttggtgtggaatttctgaaaaactgtacttgttccttttgcaccaaaggtatattttttagcaaacaattttaacttcattgcatgtttttgta 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38029441 cacatgttggtgtggaatttctgaaaaactgtacttgttccttttgcaccaaaggtatattttttagcaaacaattttaacttcattgcatgtttttgta 38029342  T
105 ttcttatgatg 115  Q
    |||||||||||    
38029341 ttcttatgatg 38029331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 202
Target Start/End: Complemental strand, 38029278 - 38029248
Alignment:
172 ctagctggttatatctggtcggatctccatt 202  Q
    |||||||||||||||||||||||||||||||    
38029278 ctagctggttatatctggtcggatctccatt 38029248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University