View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2703_high_73 (Length: 202)
Name: NF2703_high_73
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2703_high_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 5 - 115
Target Start/End: Complemental strand, 38029441 - 38029331
Alignment:
| Q |
5 |
cacatgttggtgtggaatttctgaaaaactgtacttgttccttttgcaccaaaggtatattttttagcaaacaattttaacttcattgcatgtttttgta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38029441 |
cacatgttggtgtggaatttctgaaaaactgtacttgttccttttgcaccaaaggtatattttttagcaaacaattttaacttcattgcatgtttttgta |
38029342 |
T |
 |
| Q |
105 |
ttcttatgatg |
115 |
Q |
| |
|
||||||||||| |
|
|
| T |
38029341 |
ttcttatgatg |
38029331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 202
Target Start/End: Complemental strand, 38029278 - 38029248
Alignment:
| Q |
172 |
ctagctggttatatctggtcggatctccatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38029278 |
ctagctggttatatctggtcggatctccatt |
38029248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University