View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2703_low_17 (Length: 455)
Name: NF2703_low_17
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2703_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 6e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 12 - 181
Target Start/End: Complemental strand, 43726829 - 43726661
Alignment:
| Q |
12 |
agatgaagggaaaataataaatggacgagagagagtaatataagcatgagaaacacaaagtcactctgactttccactgaattctaatttctaaccccat |
111 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43726829 |
agatgaagggaaaataataactagacgagagagagtaatataagaatgagaaacacaaagtcactctgactttccactgcattctaatttctaaccccat |
43726730 |
T |
 |
| Q |
112 |
ttcaaaatcgtgattgatctaatactgtggttgttcccatcactagcagttcccttatggtttttagttg |
181 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
43726729 |
ttc-aaatcgtgattgatctaatactgtggttgttgccatctctagcagttcccttatggtttttagttg |
43726661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University