View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2703_low_17 (Length: 455)

Name: NF2703_low_17
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2703_low_17
NF2703_low_17
[»] chr8 (1 HSPs)
chr8 (12-181)||(43726661-43726829)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 6e-72; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 12 - 181
Target Start/End: Complemental strand, 43726829 - 43726661
Alignment:
12 agatgaagggaaaataataaatggacgagagagagtaatataagcatgagaaacacaaagtcactctgactttccactgaattctaatttctaaccccat 111  Q
    |||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
43726829 agatgaagggaaaataataactagacgagagagagtaatataagaatgagaaacacaaagtcactctgactttccactgcattctaatttctaaccccat 43726730  T
112 ttcaaaatcgtgattgatctaatactgtggttgttcccatcactagcagttcccttatggtttttagttg 181  Q
    ||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||    
43726729 ttc-aaatcgtgattgatctaatactgtggttgttgccatctctagcagttcccttatggtttttagttg 43726661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University