View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2703_low_49 (Length: 290)
Name: NF2703_low_49
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2703_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 87 - 270
Target Start/End: Original strand, 45596141 - 45596324
Alignment:
| Q |
87 |
ccaacaagagtttgtatctactgatataccttccccatctgttcaatgtgaggagaaaaacgaagagcttcataacaagcacggcagcgaagcttttgaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596141 |
ccaacaagagtttgtatctactgatataccttccccatctgttcaatgcgaggagaaaaacgaagagcttcataacaagcacggcagcgaagcttttgaa |
45596240 |
T |
|
| Q |
187 |
tatcttgaggtagatggttatttgctagtcgagaatctgatttggaagcttgaataacctttagtcaatcgtaagaaaattgta |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596241 |
tatcttgaggtagatggttatttgctagtcgagaatctgatttggaagcttgaataacctttagtcaatcgtaagaaaattgta |
45596324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 110 - 246
Target Start/End: Original strand, 27151886 - 27152022
Alignment:
| Q |
110 |
atataccttccccatctgttcaatgtgaggagaaaaacgaagagcttcataacaagcacggcagcgaagcttttgaatatcttgaggtagatggttattt |
209 |
Q |
| |
|
||||||||| || || |||||||| ||||||| ||||| || |||||||| ||||| ||||| |||||||||||||| ||| ||||||||| ||| || |
|
|
| T |
27151886 |
atatacctttcctatttgttcaatacgaggagagaaacggagtgcttcatagcaagctcggcaacgaagcttttgaatgtctggaggtagattgttgttc |
27151985 |
T |
|
| Q |
210 |
gctagtcgagaatctgatttggaagcttgaataacct |
246 |
Q |
| |
|
||||| || ||||| ||||| ||||| ||||||||| |
|
|
| T |
27151986 |
gctagccgtgaatcggattttgaagcacgaataacct |
27152022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University