View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2703_low_70 (Length: 233)
Name: NF2703_low_70
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2703_low_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 116 - 215
Target Start/End: Original strand, 30429862 - 30429961
Alignment:
| Q |
116 |
gttttattggtttgggtcataaatcaacctttacaaagacggttcgtcaagaatgactgagatttatttaagagattgatacatcacaatatagttcgtc |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30429862 |
gttttatcggtttgggtcataaatcaacctttacaaagactattcgtcaaggatgactgagatctatttaagatattgatacatcacaatatagttcgtc |
30429961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 132 - 211
Target Start/End: Original strand, 30414667 - 30414746
Alignment:
| Q |
132 |
tcataaatcaacctttacaaagacggttcgtcaagaatgactgagatttatttaagagattgatacatcacaatatagtt |
211 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||||| |||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
30414667 |
tcataaatcaatctttacaaagactattcatcaaggatgactgagatttatttaagagattgatccatcgtaatatagtt |
30414746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University