View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2703_low_74 (Length: 216)
Name: NF2703_low_74
Description: NF2703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2703_low_74 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 12320994 - 12320798
Alignment:
| Q |
19 |
acttatgagacttatcaattatatttctaatatttaattaagaataaataattctttttagtattctatgtataaatcttacatggagttatgtagtttt |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
12320994 |
acttatgagacttatcaactatatttctaatatttaattaagaataaataattcttttttgtattctatgtataa-tcttacatggagttatgtagttct |
12320896 |
T |
 |
| Q |
119 |
tagtaaattctttgtgggcatgaagatcttgtgttactcacgctgtaaagattgaaaatgaatgtgatagagaggtatagatagtggtgatatgtctg |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
12320895 |
tagtaaattccttgtgggcatgaagatcttgtgttactcacgctgtaaagattgaaaatgaatgtgatagagaggtgtagatggtggtgaaatgtctg |
12320798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University