View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2704_low_2 (Length: 252)
Name: NF2704_low_2
Description: NF2704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2704_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 25 - 241
Target Start/End: Complemental strand, 37503381 - 37503165
Alignment:
| Q |
25 |
ttctaaaacataacatgtaatacatattttttgactagggcaaacataactcattttgttagcaacaatgtgatcaataaactcaaactagttaaagatg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37503381 |
ttctaaaacataacatgtaatacatattttttgactagggcaaacataactcattttgttagcaacaatgtgataaataaactcaaactagttaaagatg |
37503282 |
T |
 |
| Q |
125 |
tatccgtcctagttagtgtatgagctacctcaatggtttgttctcaactctagagttactaaaattgaatacaaccaaaaggaatgtctacaatctgtaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37503281 |
tatccgtcctagttagtgtatgagctacctcaatggtttgttctcaactctagagttactaaaattgaatataaccaaaaggaatgtctacaatctgtaa |
37503182 |
T |
 |
| Q |
225 |
ttatggcaccaaaatct |
241 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37503181 |
ttatggcaccaaaatct |
37503165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University