View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_high_47 (Length: 240)
Name: NF2705_high_47
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 26011013 - 26010806
Alignment:
| Q |
1 |
ttgtcaaagagaaccaaagtcaacacaaattcaacattcctataaccatttaataattaataactcataaatctatcgaaaacacagaaggatttgacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
26011013 |
ttgtcaaagagaaccaaagtcaacacaaattcaacattcctataaccatttaacaattaataactca--aatctat-------------ggatttgacaa |
26010929 |
T |
 |
| Q |
101 |
ccattgtaagttcgtcggagagggtgcagatagaaacaaaatcaatggatatcataagccacaatgcgttttctctataaactctggtaatggagagaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26010928 |
ccattgtaagttcgtcggagagggtgcagatagaaacaaaatgaatggatatcacaagccacaatgcgttttctctataaactctggtaatg--gagaac |
26010831 |
T |
 |
| Q |
201 |
gtggccattcaacaagaggtgtatt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26010830 |
gtggccattcaacaagaggtgtatt |
26010806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University