View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_low_32 (Length: 280)
Name: NF2705_low_32
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 14 - 265
Target Start/End: Original strand, 564155 - 564406
Alignment:
| Q |
14 |
atataaacaggagggtgagaaacattgatgctttcttcaatcaaggctttaactgcttgtgattccaattctacaaagctattgactaatataccgtcgc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
564155 |
atataaacaggagggtgagaaacattgatgctttcttcaatcaaggctttaactgcttgtgattccaattctacaaagctattgactaatataccgtcgc |
564254 |
T |
 |
| Q |
114 |
aaagatttatccctttggaacggagaagaaaatggttgtaagactcactattcctgtcttgaaatgaagatggaagatcggttccttgaatcggtacaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
564255 |
aaagatttatccctttggaacggagaagaaaatggttgtaagactcactattcctgtcttgaaatgaagatggaagatcggttccttgaatcggtacaca |
564354 |
T |
 |
| Q |
214 |
acctgggattttgattggttcttgcaagtctttaaactcaccagaaattgtt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
564355 |
acctgggattttgattggttcttgcaagtctttaaactcaccagaaattgtt |
564406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 217 - 262
Target Start/End: Original strand, 874024 - 874069
Alignment:
| Q |
217 |
tgggattttgattggttcttgcaagtctttaaactcaccagaaatt |
262 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
874024 |
tgggattatgattggttcttgcaagtctttaaattcaccagaaatt |
874069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University