View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_low_36 (Length: 266)
Name: NF2705_low_36
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 26011347 - 26011600
Alignment:
| Q |
1 |
catcagccctagttacttatagaggtgtgctaacatctccagagttatgaaatcagccatttgttatctttcttttctttccttagtttt-ttatcattt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26011347 |
catcagccctagttacttatagaggtgtgctaacatctctagagttatgaaatcagccatttgttatctttcttttctttccttagtttttttatcattt |
26011446 |
T |
 |
| Q |
100 |
ggtttagcttagaatttgttactatctgaacaagaatccatcacacaccttttaaaattattgggactatcgtttcatcattagcacactttcaagtgca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26011447 |
ggtttagcttagaatttgttactatctgaacaagaatccatcacacaccttttaaaattattgggactatcgtttcatcattagcacactttcaagtgca |
26011546 |
T |
 |
| Q |
200 |
actctataaaaatctatcttccgaatgctatttccttttgcattttcttcctct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26011547 |
actctataaaaatctatcttccgaatgctatttccttttgcattttcttcctct |
26011600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University