View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_low_38 (Length: 265)
Name: NF2705_low_38
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_low_38 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 128 - 265
Target Start/End: Original strand, 8254581 - 8254718
Alignment:
| Q |
128 |
caataatgatttgacctgatcaacaaaacaccgtctagtgcagtgagcttgttgtcctcgtaagcttggaacgaagggggtgttgtatcttcaggcactc |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8254581 |
caataatgatttgacctgatcaacaatacaccgtctagtgcagtgagcttgttgtcctcgtaagcttggaacgaagggggtgttgtatcttcaggcactc |
8254680 |
T |
 |
| Q |
228 |
tgatgctcaagtcaagatatgaacaaaaaggggatgct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8254681 |
tgatgctcaagtcaagatatgaacaaaaaggggatgct |
8254718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University