View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_low_40 (Length: 259)
Name: NF2705_low_40
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_low_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 42089412 - 42089669
Alignment:
| Q |
1 |
ctagaataaatttagtttagaacgaagatttaa--aggtaataaaaat-gaaagatgaagtagagaccaatttattttttgcgcctttaatttcagtagc |
97 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089412 |
ctagaataaatttagtgtagaacgaagatttaattaggtaataaaaaaagaaagatgaagtagagaccaatttattttttgcgcctttaatttcagtagc |
42089511 |
T |
 |
| Q |
98 |
tagttcaactttgtttgtacctgtagtgtagtgtccacaaagttgagcttaggaccaactcttttgtttg-ttgaaaagccaagatattttagaaaatgc |
196 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
42089512 |
tagttcaacattgtttgtacc-----tgtagtgtccacaaagttgagcttaggaccaactcttttgtctgcttgaaaagccaagatattttagaaaatgc |
42089606 |
T |
 |
| Q |
197 |
tagtaattcagaagggaccgtttgttgcagcattatcaatatttttcgcaacatacacctatg |
259 |
Q |
| |
|
||||||||||||| | || |||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
42089607 |
tagtaattcagaatgaactgtttgttgcagcattatcaatatttttcgcaatatacagctatg |
42089669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University