View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_low_49 (Length: 241)
Name: NF2705_low_49
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_low_49 |
 |  |
|
| [»] scaffold1344 (1 HSPs) |
 |  |  |
|
| [»] scaffold0854 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 18031206 - 18030977
Alignment:
| Q |
1 |
aaataagtcaatgtgagaaattagaaaacatatttactgatgaaaggagagtggat---gacaagattgaggaaatagacgatggtgataatgataaaaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18031206 |
aaataagtcaatgtgagaaattagaaaacatatttactgatgaaaggagagtggatattgacaagattgaggaaatagacaatggtgataatgataaaat |
18031107 |
T |
 |
| Q |
98 |
gaatagttgcaactcaatgttttcaaagctgaaagttctcaaaatctttgaatgtcccctattacgatcaatatttccatttctctctgctcaagacctt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18031106 |
gaatagttgcaactcaatgttttcaaagctgaaagttctcaaaatctttgaatgtcccctattacgatcaatatttccatttctctctgctcaagacctt |
18031007 |
T |
 |
| Q |
198 |
ttgttaccaaagtcaatcaggatacaaagt |
227 |
Q |
| |
|
||||||||| ||||||||| |||| ||||| |
|
|
| T |
18031006 |
ttgttaccagagtcaatcatgatagaaagt |
18030977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 82 - 136
Target Start/End: Original strand, 27344175 - 27344229
Alignment:
| Q |
82 |
gtgataatgataaaaagaatagttgcaactcaatgttttcaaagctgaaagttct |
136 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||| |||| |||||| |||| |
|
|
| T |
27344175 |
gtgataatgataataacaatagttgcaactcaatgtttccaaatctgaaatttct |
27344229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 69 - 139
Target Start/End: Original strand, 27370631 - 27370701
Alignment:
| Q |
69 |
gaaatagacgatggtgataatgataaaaagaatagttgcaactcaatgttttcaaagctgaaagttctcaa |
139 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||| ||||||||||||| |||| |||||| ||||||| |
|
|
| T |
27370631 |
gaaatagttgatggtgataatgataataacgatagttacaactcaatgtttccaaatctgaaatttctcaa |
27370701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 134
Target Start/End: Complemental strand, 18723249 - 18723184
Alignment:
| Q |
69 |
gaaatagacgatggtgataatgataaaaagaatagttgcaactcaatgttttcaaagctgaaagtt |
134 |
Q |
| |
|
||||||| ||||||||||||||||| || || | |||||||||||||||| |||| ||||||||| |
|
|
| T |
18723249 |
gaaatagttgatggtgataatgataacaacaaaatttgcaactcaatgtttccaaatctgaaagtt |
18723184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 138
Target Start/End: Complemental strand, 27401077 - 27401041
Alignment:
| Q |
102 |
agttgcaactcaatgttttcaaagctgaaagttctca |
138 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
27401077 |
agttgcaactcaatgtttccaaacctgaaagttctca |
27401041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1344 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1344
Description:
Target: scaffold1344; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 82 - 137
Target Start/End: Original strand, 862 - 917
Alignment:
| Q |
82 |
gtgataatgataaaaagaatagttgcaactcaatgttttcaaagctgaaagttctc |
137 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
862 |
gtgataatgataataaaaatagttgcaactcaatgtttccaaatctgaaatttctc |
917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0854 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0854
Description:
Target: scaffold0854; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 83 - 137
Target Start/End: Complemental strand, 4134 - 4080
Alignment:
| Q |
83 |
tgataatgataaaaagaatagttgcaactcaatgttttcaaagctgaaagttctc |
137 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
4134 |
tgataatgataaaaacaaaagttgcaactcaatgtttccaaatctgaaatttctc |
4080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 82 - 137
Target Start/End: Complemental strand, 73078 - 73023
Alignment:
| Q |
82 |
gtgataatgataaaaagaatagttgcaactcaatgttttcaaagctgaaagttctc |
137 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||| |||| ||||| ||||| |
|
|
| T |
73078 |
gtgataatgataataacaatagttgcaactcaatgtttccaaatttgaaatttctc |
73023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University