View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_low_64 (Length: 215)
Name: NF2705_low_64
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_low_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 10767931 - 10767753
Alignment:
| Q |
15 |
cagagacgacactagtattgacacgtggacacggttggtaaattaaaaatatggtataattgaaggaaaccatggtgtcgtgttggtgtctgataggaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
10767931 |
cagagacgacactagtattgacacgtggacacggttggtaaattaaaaatatggtataattgaaggaaaccatggtgtcgtgttggtgtccgatatgaca |
10767832 |
T |
 |
| Q |
115 |
catgctagacatcgtacatgctacaatttaaagtgttggtgaaactaacaataataacaaaaattgatagagcacataa |
193 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10767831 |
catgctagacattgtacatgctacaatttaaagtgttggtgaaactaacaataataacaaaaattgatagagcacataa |
10767753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University