View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_low_67 (Length: 209)
Name: NF2705_low_67
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_low_67 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 42243331 - 42243539
Alignment:
| Q |
1 |
atatcatggcagatgaaatatttaggttggattgtcaactaatgttacatacaaaattggcaaaaggcaggaattgatatttctgtttggatctactgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42243331 |
atatcatggcagatgaaatatttaggttggattgtcaactaatgttacatacaaaattggcaaaaggcaggaattgatatttctgtttggatctactgat |
42243430 |
T |
|
| Q |
101 |
atgtatctgttacaaccacaaattcaaatcatttaaacacacatgtaaaattacacattatttaattagttcaatagtgaaaaaatttgactattcattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42243431 |
atgtatctgttacaaccacaaattcaaatcatttaaacacacatgtaaaattacacattatttaattagttcaatagtgaaaaaatttgactattcattt |
42243530 |
T |
|
| Q |
201 |
cgaactttt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
42243531 |
cgaactttt |
42243539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University