View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2705_low_69 (Length: 201)

Name: NF2705_low_69
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2705_low_69
NF2705_low_69
[»] chr2 (1 HSPs)
chr2 (1-112)||(43799907-43800018)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 43800018 - 43799907
Alignment:
1 tacagctgtggttaattagatacactactataatagttgaagttcatgtttagattgaataggattaagctaaatcatgacttgctaaatcataactttt 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43800018 tacagctgtggttaattagatacactactataatagtttaagttcatgtttagattgaataggattaagctaaatcatgacttgctaaatcataactttt 43799919  T
101 gttacattatgg 112  Q
    ||||||||||||    
43799918 gttacattatgg 43799907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University