View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2705_low_69 (Length: 201)
Name: NF2705_low_69
Description: NF2705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2705_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 43800018 - 43799907
Alignment:
| Q |
1 |
tacagctgtggttaattagatacactactataatagttgaagttcatgtttagattgaataggattaagctaaatcatgacttgctaaatcataactttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43800018 |
tacagctgtggttaattagatacactactataatagtttaagttcatgtttagattgaataggattaagctaaatcatgacttgctaaatcataactttt |
43799919 |
T |
|
| Q |
101 |
gttacattatgg |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43799918 |
gttacattatgg |
43799907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University