View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2706_low_10 (Length: 253)
Name: NF2706_low_10
Description: NF2706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2706_low_10 |
 | |
|
| [»] scaffold0288 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0288 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 4419 - 4183
Alignment:
| Q |
18 |
caaccaagacatcaaaatgcaaaaccagagacttgcttacttcaggtgaaagtaaatggtgaatagtccaaaccatcgtgcaaataccaaaattttaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4419 |
caaccaagacatcaaaatgcaaaaccagagacttgcttacttcaggtgaaagtaaatggtcaatagtccaaaccatcgtgccaataccaaaa-tttaatt |
4321 |
T |
|
| Q |
118 |
taatagctatagatatttttagtatattcatacttttg-cccct-cacaaaat-gatgccaagctctgcaggtcgcaaagacatgaaaagttttaatgtc |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4320 |
taatagctatagata-ttttagtatattcatacttttgtcccctccacaaaatagatgccaagctctgcaggtcgcaaagacatgaaaagttttaatgtc |
4222 |
T |
|
| Q |
215 |
gcggtccaaattgcgttcgcaaataatgtgtatgtttct |
253 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4221 |
gcggtctaaattgcgttcgcatataatgtgtatgtttct |
4183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University