View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2706_low_11 (Length: 242)
Name: NF2706_low_11
Description: NF2706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2706_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 73 - 229
Target Start/End: Original strand, 42212352 - 42212508
Alignment:
| Q |
73 |
tatttaatgcagttgaatttgaatgtggttttgttgaagttctaaattgtcgtttttgacaaaatcgcgatgacttgtcatcttgattctattgaactta |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42212352 |
tatttaatgcagttgaatttgaatgtggttttgttgaagttctaaattgtcgtttttgacaaaatcgcgatgacttgtcatcttgattctattgaactta |
42212451 |
T |
 |
| Q |
173 |
tgtgaatccgaacatgtaactgaaaactattttaatgtctttcgaaatgattattct |
229 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
42212452 |
tgtgaatccgaacatgtaaccgaaaactatttttatgtctttcgaaatgatcattct |
42212508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 42212244 - 42212318
Alignment:
| Q |
1 |
ttgttgaagttcaataacgtcacagttgataaaattacaacgagacacacttttgataaaatattgttattctat |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42212244 |
ttgttgaagttcaataacgtcacagttgataaaattacgacgagacacacttttgataaaatattgttattctat |
42212318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University