View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2706_low_6 (Length: 367)
Name: NF2706_low_6
Description: NF2706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2706_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 55 - 358
Target Start/End: Complemental strand, 4337650 - 4337348
Alignment:
| Q |
55 |
cagaacagttcgtgcttactcaaattaaaacccccaggagttggctttgtggtctgaagacttgggatctaggagcgtgctcttctctaggtatcgaatt |
154 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4337650 |
cagaacaattcgtgcttactcaaattaaaacccctaggagttggctttgtggtgtgaagacttgggatctaggagcgtgctcttctctaggtatcgaatt |
4337551 |
T |
|
| Q |
155 |
tgaattccccaagtaccaaaaattcttgtgttgggcccaatggagatacaaagctttgttcttgtagcaattggg-gcccccgctagtggttagtgggat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4337550 |
tgaattccccaagtaccaaaaattcttgtgttgggcc---gctccatacaaagctttgttctggtagcaattgggcccccccgctagtggttagtgggat |
4337454 |
T |
|
| Q |
254 |
ttat-cccccggattagttggtccttaggccggatatggagttttcaagagnnnnnnntcagctcaaattaaaatttacctggcaagtctttcacatctt |
352 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4337453 |
ttatccccccggattagttggtccttaggccggatatggagttttcaagagaaaaaaatcagctcaaattaaaatttacctggcaagtctttcacatctt |
4337354 |
T |
|
| Q |
353 |
tcatct |
358 |
Q |
| |
|
|||||| |
|
|
| T |
4337353 |
tcatct |
4337348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University