View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2707_high_10 (Length: 323)
Name: NF2707_high_10
Description: NF2707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2707_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 996086 - 995768
Alignment:
| Q |
1 |
acaagaaccgtgaaagctatgagtgaggtagaggcatttgctttagaagcagaggaattgaagtttgttgcatcacagtttagacacatacatagtagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
996086 |
acaagaaccgtgaaagctatgagtgaggtagaggcatttgctttagaagcagaggaattgaagtttgttgcatcacagtttagacacatacatagtagac |
995987 |
T |
|
| Q |
101 |
aggttcagcatacattccgtttctattcgcaacaatggcaaacatgggctgcaatctatattcaagctgcatggaggaagcatttaaggcgaagacgaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
995986 |
aggttcagcatacattccgtttctattcgcaacaatggcgaacatgggctgcaatctatattcaagctgcatggaggaagcatttaaggcgaagacgaag |
995887 |
T |
|
| Q |
201 |
gaaggaggaagaagaatactacgaggattacgcgggaagtgatgattctgcaagggcgttggttccgggtcctgaaagttcgtcaaaatttggacttaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
995886 |
gaaggaggaagaagaatactacgaggattacgcgggaagtgatgattctgcaagggcgttggttccgggtcctgaaagttcgtcaaaatttggacttaat |
995787 |
T |
|
| Q |
301 |
acaacagtctctgcttctc |
319 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
995786 |
acaacagtctatgcttctc |
995768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University