View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2708_low_2 (Length: 232)
Name: NF2708_low_2
Description: NF2708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2708_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 18189172 - 18188952
Alignment:
| Q |
1 |
attccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatccccagcatttggagcaacttgagtttcaacattctcctcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189172 |
attccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatccccagcatttggagcaacttgagtttcaacattctcctcag |
18189073 |
T |
 |
| Q |
101 |
ggaccgagttttcgtccattggaatttctctgcaagaatcagcatccgcattcacttgctcaccacccacaacattttctcgaggcagagaatcttcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189072 |
ggaccgagttttcgtccattggaatttctctgcaagaatcagcatccgcattcacttgctcaccacccacaacattttctcgaggcagagaatcttcttg |
18188973 |
T |
 |
| Q |
201 |
aaaccctaatttcaatttctt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18188972 |
aaaccctaatttcaatttctt |
18188952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 18189277 - 18189186
Alignment:
| Q |
1 |
attccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatccccagcatttggagcaacttgagtttcaacatt |
92 |
Q |
| |
|
||||||||||||||||||||||||||| |||| | ||||||||| ||| ||||||| |||| ||| | || |||||||||||||| |||| |
|
|
| T |
18189277 |
attccagaaccttctccgacctcacaacttgatctattcccctcaaccaatttaacattcccaccatcttgaacaacttgagtttcagcatt |
18189186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 86 - 141
Target Start/End: Complemental strand, 52895044 - 52894989
Alignment:
| Q |
86 |
caacattctcctcagggaccgagttttcgtccattggaatttctctgcaagaatca |
141 |
Q |
| |
|
||||||| ||||| |||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
52895044 |
caacattttcctcttggacagggttttcgtccattggaatttctctgcaagaatca |
52894989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University