View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2709_high_8 (Length: 248)
Name: NF2709_high_8
Description: NF2709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2709_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 16562577 - 16562381
Alignment:
| Q |
1 |
tggggctttattattagcttaaaataatactccagtaacaaaattccgaggccaat------gagctgttgttattttcaatcttggcattttcctctcc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16562577 |
tggggctttattattagcttaaaataatactccagtaacaaaattccgaggccaatattaatgagctgttgttattttcaaccttggcattttcctctcc |
16562478 |
T |
 |
| Q |
95 |
aggagagaaggaattgtatgccttaatttgtcagagcctagtggctatgcgtcatac-ttggtgaaaccaaatgcatattatgaaaactgagtttcc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16562477 |
aggagagaaggaattgtatgccttaatttgtcagagcctagtggctatgcgtcatacattggtgaaaccaattgcatattatgaaaactgagtttcc |
16562381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University