View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2709_low_6 (Length: 254)
Name: NF2709_low_6
Description: NF2709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2709_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 24 - 236
Target Start/End: Original strand, 19275708 - 19275918
Alignment:
| Q |
24 |
aaattattcttgtagtttgatcaccatcactatgtgaatttgatatatgctatcaagaaattgttactcaaggattgcaatgtgaacattgtgtcatact |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19275708 |
aaattattcttgtagtttgatcaccatcactatgtgaatttgatatatgctatcaagaa-ttgttactcaaggattgcaatgtgaacattgtgtcatact |
19275806 |
T |
 |
| Q |
124 |
cttcgagaggataactcttctgctgatcatttagctaagttggg--acatagaagtagagaaagcagcatttccctccaaaatgtcgtttatcttgctga |
221 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
19275807 |
cttcgagacgataactcttctgctgattatttagctaagttgggacacatagaagtagaga---gagtatttccctccaaaatgtcgtttatcttgctga |
19275903 |
T |
 |
| Q |
222 |
aatatgtcatgggtg |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19275904 |
aatatgtcatgggtg |
19275918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University