View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710-Insertion-11 (Length: 209)
Name: NF2710-Insertion-11
Description: NF2710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710-Insertion-11 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 108 - 209
Target Start/End: Complemental strand, 6272705 - 6272604
Alignment:
| Q |
108 |
aaaatgtatctcttatttgatataagttttgtaccttccaatatgtcagttttattttcataaaacatgttttcaggaaagacatttttgatgatacctt |
207 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6272705 |
aaaatatatctcttattcgatataagttttgtaccttccaatatgtcagttttattttcataaaacatgttttcaggaaagacatttctgatgatacctt |
6272606 |
T |
|
| Q |
208 |
ta |
209 |
Q |
| |
|
|| |
|
|
| T |
6272605 |
ta |
6272604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 114 - 209
Target Start/End: Complemental strand, 6263863 - 6263768
Alignment:
| Q |
114 |
tatctcttatttgatataagttttgtaccttccaatatgtcagttttattttcataaaacatgttttcaggaaagacatttttgatgataccttta |
209 |
Q |
| |
|
|||| ||||||| || |||||||| ||| |||||||||| | |||||||||||||||||| ||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
6263863 |
tatcccttattttatgtaagttttttactttccaatatgcctcttttattttcataaaacaagttttcatgaaagacatttttgaggatgccttta |
6263768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 6272805 - 6272769
Alignment:
| Q |
8 |
cctcgtagacttttctcgttttcaaatacgatgaaag |
44 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
6272805 |
cctcgtagacatttcttgttttcaaatacgatgaaag |
6272769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University