View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710-Insertion-16 (Length: 137)
Name: NF2710-Insertion-16
Description: NF2710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710-Insertion-16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 7 - 137
Target Start/End: Original strand, 12062977 - 12063108
Alignment:
| Q |
7 |
acttttccggtgccaccgtagccgattaaattatcgtcatccaaatgacttacttcatctgcatcaatatccacttggtgaaaagatgcttgtttccatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12062977 |
acttttccggtgccaccgtagccgattaaattatcgtcatccaaatgacttacttcatctgcatcaatatccacttggtgaaaagatgcttgtttccatt |
12063076 |
T |
 |
| Q |
107 |
tttgacttgcttccttttcg-cctttttgtaa |
137 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
12063077 |
tttgacttgcttccttttcgtcctttttgtaa |
12063108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University