View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710R-Insertion-18 (Length: 437)
Name: NF2710R-Insertion-18
Description: NF2710R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710R-Insertion-18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 409; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 409; E-Value: 0
Query Start/End: Original strand, 9 - 437
Target Start/End: Original strand, 33804676 - 33805104
Alignment:
| Q |
9 |
catagccttgcctatatcaagaccccttgaaaccaacaccaaagcctgattgcccagaaaccgaccccaaacctaagaaaaccttagcacaaaccataag |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33804676 |
catagccttgcctatatcaagaccccctgaaaccaacaccaaagcctgattgcccagaaaccgaccccaaacctaagaaaaccttagcacaaaccataag |
33804775 |
T |
|
| Q |
109 |
caacgtttgcgatataccaacatcacaactaccacaatcggtgatcaaaggggataaggtctctatatccatcctagaagatgattacacggtgggatta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33804776 |
caacgtttgcgatataccaacatcacaactaccacaatcggtgatcaaaggggataaggtctctatatccatcccagaagatgattacacggtgggatta |
33804875 |
T |
|
| Q |
209 |
gaagcatgcaagcacaacttacatgctaggatcatttaccctaaaggtgctacccctttaactgtattttccttgagaaacaaacttactgctcattgga |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33804876 |
gaagcatgcaagcacaacttacatgctaggatcatttaccctaaaggtgctacccctctaactgtattttccttgagaaacaaacttactgctcattgga |
33804975 |
T |
|
| Q |
309 |
aagatctagggcgatggggagttcaagttattaggaaaggattctatgaatttactttctccaacttagaagatctgaagagggtaatatccattggctc |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33804976 |
aagatctagggcgatggggagttcaagttattaggaaaggattctatgaatttactttctccaacttagaagatctgcagagggtaatatccattggctc |
33805075 |
T |
|
| Q |
409 |
atggaatttgagtcccggcttcatcaaat |
437 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
33805076 |
atagaatttgagtcccggcttcatcaaat |
33805104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University