View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2710R-Insertion-2 (Length: 171)

Name: NF2710R-Insertion-2
Description: NF2710R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2710R-Insertion-2
NF2710R-Insertion-2
[»] chr4 (1 HSPs)
chr4 (9-171)||(55067560-55067722)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 3e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 3e-80
Query Start/End: Original strand, 9 - 171
Target Start/End: Complemental strand, 55067722 - 55067560
Alignment:
9 aaaattaggttggagtatcccttgcactctgtttctaacataatcatacaggttaaaaaattcaacaaagaaaaagattgtttgtttataaatttataag 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
55067722 aaaattaggttggagtatcccttgcactctgtttctaacataatcatacaggttaaaaaattgaacaaagaaaaagattgtttgtttataaatttataag 55067623  T
109 aaacagacatattgaaatggaaaatagagaataccataacaaaaattgcatcttatttcttta 171  Q
    |||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||    
55067622 aaacagacatatagaaatggaaaatagagaataccacaacaaaaattgcatcttatttcttta 55067560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University