View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710R-Insertion-2 (Length: 171)
Name: NF2710R-Insertion-2
Description: NF2710R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710R-Insertion-2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 3e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 3e-80
Query Start/End: Original strand, 9 - 171
Target Start/End: Complemental strand, 55067722 - 55067560
Alignment:
| Q |
9 |
aaaattaggttggagtatcccttgcactctgtttctaacataatcatacaggttaaaaaattcaacaaagaaaaagattgtttgtttataaatttataag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55067722 |
aaaattaggttggagtatcccttgcactctgtttctaacataatcatacaggttaaaaaattgaacaaagaaaaagattgtttgtttataaatttataag |
55067623 |
T |
 |
| Q |
109 |
aaacagacatattgaaatggaaaatagagaataccataacaaaaattgcatcttatttcttta |
171 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55067622 |
aaacagacatatagaaatggaaaatagagaataccacaacaaaaattgcatcttatttcttta |
55067560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University