View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2710R-Insertion-24 (Length: 338)

Name: NF2710R-Insertion-24
Description: NF2710R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2710R-Insertion-24
NF2710R-Insertion-24
[»] chr5 (1 HSPs)
chr5 (9-243)||(7059225-7059459)


Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 243
Target Start/End: Original strand, 7059225 - 7059459
Alignment:
9 ccaatgtcagaacctgtttcataatcttctgcaactatgcttccatatcgacacgtgtcatccatggccattgatctgtgtggtggcaggtctgaatcaa 108  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7059225 ccaatgtcagaacctgtttcataatcttctgcaactaagcttccatatcgacacgtgtcatccatggccattgatctgtgtggtggcaggtctgaatcaa 7059324  T
109 agggtggaaccaccacctcagagacggtggtgtttatggtggttgtggattgcattgcttggttttctgagaagtcttgctgtctattgattgcaactag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7059325 agggtggaaccaccacctcagagacggtggtgtttatggtggttgtggattgcattgcttggttttctgagaagtcttgctgtctattgattgcaactag 7059424  T
209 tgaagggtcgttttcagctgcattgatatcagatc 243  Q
    |||||||||||||||||||||||||||||||||||    
7059425 tgaagggtcgttttcagctgcattgatatcagatc 7059459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University