View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710R-Insertion-24 (Length: 338)
Name: NF2710R-Insertion-24
Description: NF2710R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710R-Insertion-24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 243
Target Start/End: Original strand, 7059225 - 7059459
Alignment:
| Q |
9 |
ccaatgtcagaacctgtttcataatcttctgcaactatgcttccatatcgacacgtgtcatccatggccattgatctgtgtggtggcaggtctgaatcaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059225 |
ccaatgtcagaacctgtttcataatcttctgcaactaagcttccatatcgacacgtgtcatccatggccattgatctgtgtggtggcaggtctgaatcaa |
7059324 |
T |
 |
| Q |
109 |
agggtggaaccaccacctcagagacggtggtgtttatggtggttgtggattgcattgcttggttttctgagaagtcttgctgtctattgattgcaactag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059325 |
agggtggaaccaccacctcagagacggtggtgtttatggtggttgtggattgcattgcttggttttctgagaagtcttgctgtctattgattgcaactag |
7059424 |
T |
 |
| Q |
209 |
tgaagggtcgttttcagctgcattgatatcagatc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059425 |
tgaagggtcgttttcagctgcattgatatcagatc |
7059459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University