View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710R-Insertion-25 (Length: 334)
Name: NF2710R-Insertion-25
Description: NF2710R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710R-Insertion-25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 9 - 334
Target Start/End: Original strand, 29220333 - 29220658
Alignment:
| Q |
9 |
aatctccctatcacaactttggtccaaccaacctactataggtttgggcccttgttttcacttagagcacatatggctgaagcaaggctaggttctagtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29220333 |
aatctccctatcacaactttggtccaaccaacctactataggtttgagcccttgttttcacttagagcacatatggctgaagcaaggctaggttctagtg |
29220432 |
T |
 |
| Q |
109 |
attcattcactaaacattgcatgacggtgattcgagaacattacttgaaggtgtatacgtcgtcttcgaagtggtccacgactcaaattattggccccgg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
29220433 |
attcattcactaaacattgcatgacggtgattcgagaacattacttgaaggtgtatacgtcgtctttgaagtggtccacgactcaaattattggcccgag |
29220532 |
T |
 |
| Q |
209 |
tataaaggtttgtcaatatgccacaatccaaccatgtgaaggttaaagaaagatttcccaaacaatactcgcattacgattgaaatggacgccttagaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29220533 |
tataaaggtttgtcaatatgccacaatccaaccatgcgaaggttaaagaaagatttcccaaacaatagtcgcattacgattgaaatggacgccttagaaa |
29220632 |
T |
 |
| Q |
309 |
aacagtcaagataaatatgaactgtg |
334 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
29220633 |
aacagttaagataaatatgaactgtg |
29220658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University