View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710R-Insertion-27 (Length: 288)
Name: NF2710R-Insertion-27
Description: NF2710R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710R-Insertion-27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-137
Query Start/End: Original strand, 9 - 283
Target Start/End: Original strand, 49717636 - 49717913
Alignment:
| Q |
9 |
tctcccagtagaaatcatcaatatcaggtcgtgaacatactcgatgaattaagattctagaa---gaagaataggtgattctggaaagggggaattggga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
49717636 |
tctcccagtagaaatcatcaatatcaggtcgtgaacatactcgatgaattaagattctagaagaagaagaatatgtgattctggaaagggggaattggga |
49717735 |
T |
|
| Q |
106 |
tattgagcaatccaatctgcgagttagggtttgggaatggaaagggattacaaatgggtatctagcacaaacagtacccatcattactcaaatcttcaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49717736 |
gattgagcaatccaatctgcgagttagggtttgggaatggaaagggattacaaatgggtatctagcacaaacagtacccatcattactcaaatcttcaaa |
49717835 |
T |
|
| Q |
206 |
cttcacarttcacaaaaaatatcctagtattattttgtttcaaatgaatcaatagaccgtatgagactgcaatttggc |
283 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
49717836 |
cttcacaattcacaaaaaatatcctagtattattttgtttcaaatgaatcaattgaccgtatgagactacaatttggc |
49717913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University