View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710_high_14 (Length: 364)
Name: NF2710_high_14
Description: NF2710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 112 - 346
Target Start/End: Complemental strand, 7059459 - 7059225
Alignment:
| Q |
112 |
gatctgatatcaatgcagctgaaaacgacccttcactagttgcaatcaatagacagcaagacttctcagaaaaccaagcaatgcaatccacaaccaccat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059459 |
gatctgatatcaatgcagctgaaaacgacccttcactagttgcaatcaatagacagcaagacttctcagaaaaccaagcaatgcaatccacaaccaccat |
7059360 |
T |
 |
| Q |
212 |
aaacaccaccgtctctgaggtggtggttccaccctttgattcagacctgccaccacacagatcaatggccatggatgacacgtgtcgatatggaagctta |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059359 |
aaacaccaccgtctctgaggtggtggttccaccctttgattcagacctgccaccacacagatcaatggccatggatgacacgtgtcgatatggaagctta |
7059260 |
T |
 |
| Q |
312 |
gttgcagaagattatgaaacaggttctgacattgg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059259 |
gttgcagaagattatgaaacaggttctgacattgg |
7059225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University