View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710_high_18 (Length: 316)
Name: NF2710_high_18
Description: NF2710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 43937434 - 43937301
Alignment:
| Q |
1 |
gtactgtactttctttcagccaattttctcattcaaaaccttcatattcagtcgacatattgcactcattttatactatatgataaattgatagcatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43937434 |
gtactgtactttctttcagccaattttctcattcaaaaccttcatattcagtcgacatattgcactcattttatactatatgataaattgatagcatagc |
43937335 |
T |
 |
| Q |
101 |
aatgtaggcatcaaggattatgcattattcttag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43937334 |
aatgtaggcatcaaggattatgcattattcttag |
43937301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 166 - 274
Target Start/End: Complemental strand, 43937254 - 43937146
Alignment:
| Q |
166 |
gtgattcataccgccaggaattagaagctgagaatgcaaatcttttatctcgacttgctcattgccagtgctccgaggttagctactcgattgtttcata |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43937254 |
gtgattcataccgccaggaattagaagctgagaatgcaaatcttttatctcgacttgctcattgccagtgctccgaggttagctactcgattgtttcata |
43937155 |
T |
 |
| Q |
266 |
tttcttttg |
274 |
Q |
| |
|
||||||||| |
|
|
| T |
43937154 |
tttcttttg |
43937146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University